PDE4B (1 of 3)

Ensembl ID:
ENSDARG00000032868
Description:
phosphodiesterase 4B, cAMP-specific [Source:HGNC Symbol;Acc:8781]
Human Orthologue:
PDE4B
Human Description:
phosphodiesterase 4B, cAMP-specific [Source:HGNC Symbol;Acc:8781]
Mouse Orthologue:
Pde4b
Mouse Description:
phosphodiesterase 4B, cAMP specific Gene [Source:MGI Symbol;Acc:MGI:99557]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44638 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38555 Nonsense Mutation detected in F1 DNA During 2017
sa40714 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44638
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028612 Essential Splice Site 388 783 11 18
Genomic Location (Zv9):
Chromosome 6 (position 30547903)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCGCTCGATTTGGCGTCAAAACTGACAAAGAGGATTTACTGTCAAAGG[T/C]AAGGAGAAGACTGACTAATACTGGCTCTTTAGTGTGTTGGGATGTGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38555
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028612 Nonsense 396 783 12 18
Genomic Location (Zv9):
Chromosome 6 (position 30547783)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30868699
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATTTCCTGACTCTTCTCTTTCCAGGAATTAGAAGACCTGAATAGATG[G/A]GGCTTGAATATCTTTACTGTTTCAGAGTATTCAAACAACCGGCCTCTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40714
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028612 Essential Splice Site 602 783 16 18
Genomic Location (Zv9):
Chromosome 6 (position 30546774)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30867690
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACAAGCTCGGGAGTCTTGCTTCTGGACAACTACACAGACAGGATACAG[G/A]TACAGTAAAGGCTTCCTGATCTCCATTCCCTCAGTAAAACCAGTTGTTAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link