PDE4B (1 of 3)

Ensembl ID:
ENSDARG00000032868
Description:
phosphodiesterase 4B, cAMP-specific [Source:HGNC Symbol;Acc:8781]
Human Orthologue:
PDE4B
Human Description:
phosphodiesterase 4B, cAMP-specific [Source:HGNC Symbol;Acc:8781]
Mouse Orthologue:
Pde4b
Mouse Description:
phosphodiesterase 4B, cAMP specific Gene [Source:MGI Symbol;Acc:MGI:99557]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38555 Nonsense Mutation detected in F1 DNA During 2017
sa40714 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38555
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028612 Nonsense 396 783 12 18
Genomic Location (Zv9):
Chromosome 6 (position 30547783)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30868699
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATTTCCTGACTCTTCTCTTTCCAGGAATTAGAAGACCTGAATAGATG[G/A]GGCTTGAATATCTTTACTGTTTCAGAGTATTCAAACAACCGGCCTCTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40714
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028612 Essential Splice Site 602 783 16 18
Genomic Location (Zv9):
Chromosome 6 (position 30546774)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30867690
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACAAGCTCGGGAGTCTTGCTTCTGGACAACTACACAGACAGGATACAG[G/A]TACAGTAAAGGCTTCCTGATCTCCATTCCCTCAGTAAAACCAGTTGTTAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link