erh

Ensembl ID:
ENSDARG00000032866
ZFIN ID:
ZDB-GENE-990415-57
Description:
Enhancer of rudimentary homolog [Source:UniProtKB/Swiss-Prot;Acc:Q98874]
Human Orthologue:
ERH
Human Description:
enhancer of rudimentary homolog (Drosophila) [Source:HGNC Symbol;Acc:3447]
Mouse Orthologues:
1700018B24Rik, Erh
Mouse Descriptions:
enhancer of rudimentary homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:108089]
RIKEN cDNA 1700018B24 gene Gene [Source:MGI Symbol;Acc:MGI:1913582]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13153 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13153
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101974 Nonsense 69 104 3 4
Genomic Location:
Chromosome 20 (position 33534787)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACATAAGCCAGTTATTMGACTTTGTTGATGATCTTGCCGATCTCAGCTG[T/A]CTTGTGTAAGTAATCACAYTTTTCACTTGACAAAGCCTAATGTCTAAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/axyve4rn