pacsin1a

Ensembl ID:
ENSDARG00000032865
ZFIN ID:
ZDB-GENE-050522-155
Description:
protein kinase C and casein kinase substrate in neurons 1a [Source:RefSeq peptide;Acc:NP_001018374]
Human Orthologue:
PACSIN1
Human Description:
protein kinase C and casein kinase substrate in neurons 1 [Source:HGNC Symbol;Acc:8570]
Mouse Orthologue:
Pacsin1
Mouse Description:
protein kinase C and casein kinase substrate in neurons 1 Gene [Source:MGI Symbol;Acc:MGI:1345181]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31081 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31081
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040086 Essential Splice Site 199 260 5 6
ENSDART00000057422 Essential Splice Site 200 439 4 9
ENSDART00000134830 Essential Splice Site 199 438 4 9
ENSDART00000143731   None 163 None 5

The following transcripts of ENSDARG00000032865 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 3677999)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 3721374
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAAACTCCACGAGAAGACTGAGAAATGCAAACAGGATGTGCAGAAGG[T/A]GCGGAAAACTGGCCAAAATACAGAAACTAATTAAAGTTGCATTCGCTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link