ndrg1

Ensembl ID:
ENSDARG00000032849
ZFIN ID:
ZDB-GENE-030826-34
Description:
protein NDRG1 isoform 2 [Source:RefSeq peptide;Acc:NP_998513]
Human Orthologue:
NDRG1
Human Description:
N-myc downstream regulated 1 [Source:HGNC Symbol;Acc:7679]
Mouse Orthologue:
Ndrg1
Mouse Description:
N-myc downstream regulated gene 1 Gene [Source:MGI Symbol;Acc:MGI:1341799]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9684 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9684
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044838 Essential Splice Site 251 392 11 16
ENSDART00000102896 Essential Splice Site 238 379 9 14

The following transcripts of ENSDARG00000032849 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 36514956)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35379476
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATTGAGAGGCCTGTAGCTGGTAGCCACATTAAYGCCAGAAYYCTGAAG[T/A]AAGTCCAAAACTAAGTCAGAATAAAAAAATATTTTTATACAATGYGGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link