si:dkey-206f10.1

Ensembl ID:
ENSDARG00000032838
ZFIN ID:
ZDB-GENE-041014-154
Description:
Novel protein similar to vertebrate adenylate cyclase 8 (ADCY8) [Source:UniProtKB/TrEMBL;Acc:Q5RHR1]
Human Orthologue:
ADCY8
Human Description:
adenylate cyclase 8 (brain) [Source:HGNC Symbol;Acc:239]
Mouse Orthologue:
Adcy8
Mouse Description:
adenylate cyclase 8 Gene [Source:MGI Symbol;Acc:MGI:1341110]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37142 Nonsense Mutation detected in F1 DNA During 2017
sa43520 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37142
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041444 Nonsense 243 1187 1 18
ENSDART00000134262   None 315 None 5
ENSDART00000142543 Nonsense 243 755 1 10
Genomic Location (Zv9):
Chromosome 20 (position 43645720)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43716879
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGCTGGCTGTCTCAGACTGCTCAGGTGTTGGGTGGGCTGGCGTATGGCT[T/A]GGAAAGAGACCAGTCCTGGTATGTTCTGTTCACTTTGTTTGCCACATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43520
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041444 Nonsense 507 1187 6 18
ENSDART00000134262   None 315 None 5
ENSDART00000142543 Nonsense 507 755 6 10
Genomic Location (Zv9):
Chromosome 20 (position 43655996)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43727155
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTTCTTTGTGGGGTCCTTGGACTACAAAAATGGCAGTTTGATGTGTG[G/A]TCCTGGGATGTGGGCATTGCCAACATGCTCGAAGCTGGTGGAATCCCTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link