htra1a

Ensembl ID:
ENSDARG00000032831
ZFIN ID:
ZDB-GENE-040704-64
Description:
HtrA serine peptidase 1a [Source:RefSeq peptide;Acc:NP_001002219]
Human Orthologue:
HTRA1
Human Description:
HtrA serine peptidase 1 [Source:HGNC Symbol;Acc:9476]
Mouse Orthologue:
Htra1
Mouse Description:
HtrA serine peptidase 1 Gene [Source:MGI Symbol;Acc:MGI:1929076]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18228 Nonsense Available for shipment Available now
sa23058 Nonsense Mutation detected in F1 DNA During 2014
sa10864 Nonsense Available for shipment Available now
sa12950 Nonsense Available for shipment Available now
sa1585 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18228
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048136 Nonsense 165 479 2 9
Genomic Location:
Chromosome 17 (position 21765594)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCTCTGTTGTTTTTRTTTCAGCTCTCCATGATAACCCCAACAGCCTG[C/T]GATACAAGTACAATTTCATTGCRGWTGTCGTAGAGAAAATCGCCCCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23058
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048136 Nonsense 257 479 3 9
Genomic Location:
Chromosome 17 (position 21765945)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCAAAGATGTTGATGAAAAAGCAGACATCGCACTTATAAAGATTGATT[T/A]GCCGGTAAGAGAAGCAAACACAATGCTTTTACATTTGCAACATAAAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10864
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048136 Nonsense 331 479 5 9
Genomic Location:
Chromosome 17 (position 21784327)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAMCTAATKAAATGNTTTTTTTTTACAGTATGGCAACTCAGGAGGACCAT[T/A]RGTTAATCTGGTGAGCACTTCYTCATTTCCGAACTGCTGAAATATACCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12950
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048136 Nonsense 381 479 7 9
Genomic Location:
Chromosome 17 (position 21785121)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTAACATTTGTGGTGTTTTWCAGGTCGAGGAACAAYAAAGAAAAGATA[T/A]ATCGGTGTYCGGATGATGACCCTCACTCCTTCGYGAGTACATGCAACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1585
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048136 Essential Splice Site 392 479 7 9
Genomic Location:
Chromosome 17 (position 21785155)
KASP Assay ID:
554-1527.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACAAAGAAAAGATATATCGGTGTTCGGATGATGACCCTCACTCCTTCG[T/C]GAGTACATGCAACAAATTAATACTTATTTTAATAAGCCTAAGGAAAATTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z948da9v