rxfp2

Ensembl ID:
ENSDARG00000032820
ZFIN ID:
ZDB-GENE-040426-1225
Description:
relaxin/insulin-like family peptide receptor 2 [Source:RefSeq peptide;Acc:NP_956737]
Human Orthologue:
RXFP2
Human Description:
relaxin/insulin-like family peptide receptor 2 [Source:HGNC Symbol;Acc:17318]
Mouse Orthologue:
Rxfp2
Mouse Description:
relaxin/insulin-like family peptide receptor 2 Gene [Source:MGI Symbol;Acc:MGI:2153463]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4378 Nonsense F2 line generated During 2014
sa12070 Nonsense Available for shipment Available now
sa13851 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4378
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050328 Nonsense 308 509 13 17
ENSDART00000147775 Nonsense 308 723 13 18
Genomic Location:
Chromosome 10 (position 34878855)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTTCATGTCATTTTTATTCCATTTGCAGGAACATATCCCACAATCCTT[T/A]GCTCCATATTCACACCGGGCACTTCGATCACCTGGTGCAGCTTCAGTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12070
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050328 Nonsense 359 509 15 17
ENSDART00000147775 Nonsense 359 723 15 18
Genomic Location:
Chromosome 10 (position 34879216)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTATTATTATTTTTTGTAGATATTTTAAAGACTTTCAGTACTGTTCCTA[T/A]GCGCCACATGTACGGAAATGCAAACCTAACACCGATGGGATTTCGTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13851
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050328 None None 509 None 17
ENSDART00000147775 Nonsense 668 723 18 18
Genomic Location:
Chromosome 10 (position 34894924)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGCCCTTAACCCCATCCTCTACACCCTGACCACCAGCTTCTTCAGAGAG[C/T]AGGTGGAGCTGCTCCTTTGCCGCTKGCAGCGKCGCTCTGCCACAAAGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q3cts1t0