ktn1

Ensembl ID:
ENSDARG00000032802
ZFIN ID:
ZDB-GENE-030408-4
Description:
kinectin [Source:RefSeq peptide;Acc:NP_956375]
Human Orthologue:
KTN1
Human Description:
kinectin 1 (kinesin receptor) [Source:HGNC Symbol;Acc:6467]
Mouse Orthologue:
Ktn1
Mouse Description:
kinectin 1 Gene [Source:MGI Symbol;Acc:MGI:109153]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39175 Nonsense Mutation detected in F1 DNA During 2017
sa36502 Nonsense Available for shipment Available now
sa39176 Nonsense Mutation detected in F1 DNA During 2017
sa32174 Nonsense Available for shipment Available now
sa36503 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa42991 Essential Splice Site Mutation detected in F1 DNA During 2017
sa28919 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39175
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017376 Nonsense 304 1189 4 37
ENSDART00000041447 Nonsense 304 1234 4 35
ENSDART00000086149 Nonsense 304 1233 4 37
ENSDART00000121550 Nonsense 304 1262 4 36
ENSDART00000122996 Nonsense 255 1343 5 41
Genomic Location (Zv9):
Chromosome 17 (position 43999525)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43839203
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGGTCATTCAGATAGGCTCCGCCGCACCAACAAACCACCAGAACAAC[C/T]AAAACAATGACACTCCGCCTCCTGTTCCAGCGCCTGCCAAGCATGGCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36502
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017376 Nonsense 383 1189 6 37
ENSDART00000041447 Nonsense 383 1234 6 35
ENSDART00000086149 Nonsense 383 1233 6 37
ENSDART00000121550 Nonsense 383 1262 6 36
ENSDART00000122996 Nonsense 334 1343 7 41
Genomic Location (Zv9):
Chromosome 17 (position 44001701)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43841379
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACTGCTTTTGTTTCTTAGTCTACGGCTAAATTTGAGCCTACCCCCCAG[C/T]AGCTGGCAGAGAAAGATCGTCTCCTGAACACATTACAGGAGGAGGCGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39176
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017376 Nonsense 639 1189 12 37
ENSDART00000041447 Nonsense 639 1234 12 35
ENSDART00000086149 Nonsense 638 1233 14 37
ENSDART00000121550 Nonsense 639 1262 12 36
ENSDART00000122996 Nonsense 590 1343 13 41
Genomic Location (Zv9):
Chromosome 17 (position 44008606)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43848284
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTAATAGTCACATTATGTCACTCTTTACAGGATCTTCTAAATGAAAAC[A/T]AAACGCTCAAGGTTCAGATTGATAATCTTCAGACTCAACTCAACACTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32174
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017376 Nonsense 651 1189 12 37
ENSDART00000041447 Nonsense 651 1234 12 35
ENSDART00000086149 Nonsense 650 1233 14 37
ENSDART00000121550 Nonsense 651 1262 12 36
ENSDART00000122996 Nonsense 602 1343 13 41
Genomic Location (Zv9):
Chromosome 17 (position 44008642)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43848320
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTAAATGAAAACAAAACGCTCAAGGTTCAGATTGATAATCTTCAGACT[C/T]AACTCAACACTCAGGTATGTGTGTGGGCTGGTAGATGCGGGTGAATTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36503
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017376 Splice Site, Nonsense 784 1189 18 37
ENSDART00000041447 Splice Site, Nonsense 784 1234 18 35
ENSDART00000086149 Splice Site, Nonsense 783 1233 20 37
ENSDART00000121550 Splice Site, Nonsense 784 1262 18 36
ENSDART00000122996 Splice Site, Nonsense 783 1343 20 41
Genomic Location (Zv9):
Chromosome 17 (position 44015459)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43855137
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAAGGTTTGAAACAGCAGCTGGAAGCAGTACAGAAACAGACAACAGAA[C/T]AGGTAGAACAGAACAAATATGTAATATGTAGAGGAGAGAAATTCATTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42991
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017376 Essential Splice Site 1077 1189 30 37
ENSDART00000041447 Essential Splice Site 1077 1234 30 35
ENSDART00000086149 Essential Splice Site 1076 1233 32 37
ENSDART00000121550 Essential Splice Site 1077 1262 30 36
ENSDART00000122996 Essential Splice Site 1165 1343 35 41
Genomic Location (Zv9):
Chromosome 17 (position 44035251)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43874929
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATAGTGTTTATGTGGAAATGAAACAATAATCATTGTATATTGTGTTTA[G/T]ATGACTCAGAGGGCAATTGCACTGGATCAGGAAGTGGACAGACTGACCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28919
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017376 Nonsense 1142 1189 32 37
ENSDART00000041447   None 1234 None 35
ENSDART00000086149   None 1233 None 37
ENSDART00000121550 Nonsense 1142 1262 32 36
ENSDART00000122996 Nonsense 1230 1343 37 41
Genomic Location (Zv9):
Chromosome 17 (position 44037260)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43876938
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTCAGCTCAAAGATCTGTTGACCGAGTTGCAAAGCAAACTAGACGGCT[C/A]ATACACTGAGGCCGTGAGACAGAATGAGGAGTTGAATTTGGTAAGCCGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link