kcnd2

Ensembl ID:
ENSDARG00000032799
ZFIN ID:
ZDB-GENE-041210-70
Description:
potassium voltage-gated channel subfamily D member 2 [Source:RefSeq peptide;Acc:NP_001076336]
Human Orthologue:
KCND2
Human Description:
potassium voltage-gated channel, Shal-related subfamily, member 2 [Source:HGNC Symbol;Acc:6238]
Mouse Orthologue:
Kcnd2
Mouse Description:
potassium voltage-gated channel, Shal-related family, member 2 Gene [Source:MGI Symbol;Acc:MGI:10266

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20218 Nonsense Available for shipment Available now
sa20219 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20218
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042673 Nonsense 314 630 1 6
ENSDART00000138890 Nonsense 314 630 2 7
Genomic Location (Zv9):
Chromosome 4 (position 9432074)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10368701
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGATTTTCAAATTTTCGCGGCACTCCGCGGGGCTGCGCATCCTGGGCTA[C/A]ACGCTGAAGAGCTGCGCGTCCGAGCTGGGCTTCCTGCTCTTCTCGCTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20219
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042673 Nonsense 445 630 3 6
ENSDART00000138890 Nonsense 445 630 4 7
Genomic Location (Zv9):
Chromosome 4 (position 9613042)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10549669
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTTGCTAGAATTCGTGCGGCGAAGAGCGGCGGCGCTAACGCTTATTTG[C/T]AGTACAAACGCAATGGGATGCTGGTGGACATGGAGGAGGAGGTAACGGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link