tmem8a

Ensembl ID:
ENSDARG00000032795
ZFIN ID:
ZDB-GENE-090312-158
Description:
transmembrane protein 8A [Source:RefSeq peptide;Acc:NP_001139040]
Human Orthologue:
TMEM8A
Human Description:
transmembrane protein 8A [Source:HGNC Symbol;Acc:17205]
Mouse Orthologue:
Tmem8
Mouse Description:
transmembrane protein 8 (five membrane-spanning domains) Gene [Source:MGI Symbol;Acc:MGI:1926283]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1975 Essential Splice Site F2 line generated During 2016
sa39557 Nonsense Mutation detected in F1 DNA During 2016
sa39556 Essential Splice Site Mutation detected in F1 DNA During 2016
sa25531 Nonsense Mutation detected in F1 DNA During 2016
sa38247 Nonsense Mutation detected in F1 DNA During 2016
sa10041 Nonsense Available for shipment Available now
sa39555 Essential Splice Site Mutation detected in F1 DNA During 2016
sa32598 Nonsense Available for shipment Available now
sa39554 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa1975
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041849 Essential Splice Site 21 751 2 13
ENSDART00000138726   None 692 1 12
Genomic Location (Zv9):
Chromosome 1 (position 9016564)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9256369
KASP Assay ID:
554-2692.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGGGGTTGTTTACATCTGACGCAACCGTGACGTCACGCTCTCTTCCTA[G/T]ACCTCACTTACTTGAACGGGTTTTACTCCAAAACGCCTCAGAGGTTGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39557
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041849 Nonsense 150 751 3 13
ENSDART00000138726 Nonsense 106 692 2 12
Genomic Location (Zv9):
Chromosome 1 (position 9012883)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9252688
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGTTCCTCGCTGCACACCTGCCTAAGGACGACGGCAAGATTGAGCAG[C/T]AGGTATGTTTTTGGTGTCTTATGCCTGTTAATAGTGTTTGTTTGATTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39556
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041849 Essential Splice Site 150 751 3 13
ENSDART00000138726 Essential Splice Site 106 692 2 12
Genomic Location (Zv9):
Chromosome 1 (position 9012880)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9252685
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTCCTCGCTGCACACCTGCCTAAGGACGACGGCAAGATTGAGCAGCAG[G/A]TATGTTTTTGGTGTCTTATGCCTGTTAATAGTGTTTGTTTGATTTTTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25531
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041849 Nonsense 253 751 5 13
ENSDART00000138726 Nonsense 209 692 4 12
Genomic Location (Zv9):
Chromosome 1 (position 9009660)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9249465
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGTTCAGGCTTAAAGATCTGCCACGCATCTGTTCTCATTCCCCCATG[G/A]AACACCTGGTTACTGGTTACCGTTGAGACCAATCAACCAAACACCTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38247
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041849 Nonsense 257 751 5 13
ENSDART00000138726 Nonsense 213 692 4 12
Genomic Location (Zv9):
Chromosome 1 (position 9009649)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9249454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTAAAGATCTGCCACGCATCTGTTCTCATTCCCCCATGGAACACCTGGT[T/A]ACTGGTTACCGTTGAGACCAATCAACCAAACACCTCAGTACCTTTCTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10041
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041849 Nonsense 304 751 6 13
ENSDART00000138726 Nonsense 245 692 5 12
Genomic Location (Zv9):
Chromosome 1 (position 9008154)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9247959
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCTTCAGATTTCAAYGCTGYAGCCTTCATTCGTACCATCATTGCTCCA[C/T]AAAGCAACAGCTCAGGTGTTTTCGGTAACTCGTCTRCTKCAGCAAAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39555
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041849 Essential Splice Site 460 751 9 13
ENSDART00000138726 Essential Splice Site 401 692 8 12
Genomic Location (Zv9):
Chromosome 1 (position 9004706)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9244511
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCATTAAAGCAGCTTATGAGCATTACTTACACTTGTATTGTCTTTCCA[G/A]TGTTGACTGCACGAATGCATCGGCTACAGTGAGTGCATCTGTGAGTGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32598
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041849 Nonsense 573 751 11 13
ENSDART00000138726 Nonsense 514 692 10 12
Genomic Location (Zv9):
Chromosome 1 (position 9002932)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9242737
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGTACTCATAATGATTGTGTGTTTTGCAGTTTTACCATGCGTGTGAT[C/T]AGCCCGGTGTGACTGTGATGTGTATCATGGACTACGACACTCTCCAGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39554
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041849 Nonsense 657 751 13 13
ENSDART00000138726 Nonsense 598 692 12 12
Genomic Location (Zv9):
Chromosome 1 (position 8996451)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9236256
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAGTAGTTTTGAAATATTTCTTGTCCTCTTGTCCCCCGCCAGGTTTAT[C/T]GAGGTGTCAAACGCCATCAGTGCTACCCTCCATTATGGCGCCGCTGGGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link