tmem8a

Ensembl ID:
ENSDARG00000032795
ZFIN ID:
ZDB-GENE-090312-158
Description:
transmembrane protein 8A [Source:RefSeq peptide;Acc:NP_001139040]
Human Orthologue:
TMEM8A
Human Description:
transmembrane protein 8A [Source:HGNC Symbol;Acc:17205]
Mouse Orthologue:
Tmem8
Mouse Description:
transmembrane protein 8 (five membrane-spanning domains) Gene [Source:MGI Symbol;Acc:MGI:1926283]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1975 Essential Splice Site F2 line generated During 2015
sa25531 Nonsense Mutation detected in F1 DNA During 2015
sa10041 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1975
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041849 Essential Splice Site 21 751 2 13
ENSDART00000138726   None 692 1 12
Genomic Location:
Chromosome 1 (position 9016564)
KASP Assay ID:
554-2692.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGGGGTTGTTTACATCTGACGCAACCGTGACGTCACGCTCTCTTCCTA[G/T]ACCTCACTTACTTGAACGGGTTTTACTCCAAAACGCCTCAGAGGTTGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25531
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041849 Nonsense 253 751 5 13
ENSDART00000138726 Nonsense 209 692 4 12
Genomic Location:
Chromosome 1 (position 9009660)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGTTCAGGCTTAAAGATCTGCCACGCATCTGTTCTCATTCCCCCATG[G/A]AACACCTGGTTACTGGTTACCGTTGAGACCAATCAACCAAACACCTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10041
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041849 Nonsense 304 751 6 13
ENSDART00000138726 Nonsense 245 692 5 12
Genomic Location:
Chromosome 1 (position 9008154)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCTTCAGATTTCAAYGCTGYAGCCTTCATTCGTACCATCATTGCTCCA[C/T]AAAGCAACAGCTCAGGTGTTTTCGGTAACTCGTCTRCTKCAGCAAAGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jw9u28a2