tmem8a

Ensembl ID:
ENSDARG00000032795
ZFIN ID:
ZDB-GENE-090312-158
Description:
transmembrane protein 8A [Source:RefSeq peptide;Acc:NP_001139040]
Human Orthologue:
TMEM8A
Human Description:
transmembrane protein 8A [Source:HGNC Symbol;Acc:17205]
Mouse Orthologue:
Tmem8
Mouse Description:
transmembrane protein 8 (five membrane-spanning domains) Gene [Source:MGI Symbol;Acc:MGI:1926283]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1975 Essential Splice Site F2 line generated During 2014
sa10041 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1975
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041849 Essential Splice Site 21 751 2 13
ENSDART00000138726 None None 692 1 12
Genomic Location:
Chromosome 1 (position 9016564)
KASP Assay ID:
554-2692.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGGGGTTGTTTACATCTGACGCAACCGTGACGTCACGCTCTCTTCCTA[G/T]ACCTCACTTACTTGAACGGGTTTTACTCCAAAACGCCTCAGAGGTTGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10041
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041849 Nonsense 304 751 6 13
ENSDART00000138726 Nonsense 245 692 5 12
Genomic Location:
Chromosome 1 (position 9008154)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCTTCAGATTTCAAYGCTGYAGCCTTCATTCGTACCATCATTGCTCCA[C/T]AAAGCAACAGCTCAGGTGTTTTCGGTAACTCGTCTRCTKCAGCAAAGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jw9u28a2