pigf

Ensembl ID:
ENSDARG00000032780
ZFIN ID:
ZDB-GENE-040426-1801
Description:
phosphatidylinositol-glycan biosynthesis class F protein [Source:RefSeq peptide;Acc:NP_991208]
Human Orthologue:
PIGF
Human Description:
phosphatidylinositol glycan anchor biosynthesis, class F [Source:HGNC Symbol;Acc:8962]
Mouse Orthologue:
Pigf
Mouse Description:
phosphatidylinositol glycan anchor biosynthesis, class F Gene [Source:MGI Symbol;Acc:MGI:99462]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2636 Nonsense F2 line generated During 2017
sa24912 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa2636
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050070 Nonsense 136 219 4 6
Genomic Location (Zv9):
Chromosome 12 (position 26625346)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 25007639
KASP Assay ID:
554-2766.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCCACACTCACTACACTGAGATGTCTCTGCATTCTGGGCCCGAATGTA[C/T]AGGCGTGGATACGGGTTTTCAGCAGAGACGGGTAAATTCTAGATCAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24912
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050070 Essential Splice Site 183 219 None 6
Genomic Location (Zv9):
Chromosome 12 (position 26637549)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 25019194
KASP Assay ID:
554-7739.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCAGTCAGTTGCTTGTGCTCCTGCAAACAGTTCTCTTTGTTTTTGTCC[A/T]GGTTTGGCCCATTTCTTGTACCCTTGGGGCAACCATTGGATTTCTGACCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Weight: Genome-wide association study of anthropometric traits and evidence of interactions with age and study year in Filipino women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link