irf11

Ensembl ID:
ENSDARG00000032768
ZFIN ID:
ZDB-GENE-041114-13
Description:
interferon regulatory factor 1 [Source:RefSeq peptide;Acc:NP_991310]
Human Orthologue:
IRF1
Human Description:
interferon regulatory factor 1 [Source:HGNC Symbol;Acc:6116]
Mouse Orthologue:
Irf1
Mouse Description:
interferon regulatory factor 1 Gene [Source:MGI Symbol;Acc:MGI:96590]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37387 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37387
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048293 Nonsense 220 287 8 9
Genomic Location (Zv9):
Chromosome 21 (position 44270960)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 45677480
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTGTTTTGCTCTGGCAGCTCACTCGGCAATTGGAGCGCGATAGTTCG[C/T]AGTGGCTGCAGAACTTTGGAAAGGGGTTCCTGGCCAATGAAGTCTGCACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • C-reactive protein: Meta-analysis of genome-wide association studies in >80 000 subjects identifies multiple loci for C-reactive protein levels. (View Study)
  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Fibrinogen: Association of novel genetic Loci with circulating fibrinogen levels: a genome-wide association study in 6 population-based cohorts. (View Study)
  • Fibrinogen: Novel loci, including those related to Crohn disease, psoriasis, and inflammation, identified in a genome-wide association study of fibrinogen in 17 686 women: the Women's Genome Health Study. (View Study)
  • Platelet counts: New gene functions in megakaryopoiesis and platelet formation. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link