pde4d

Ensembl ID:
ENSDARG00000032761
ZFIN ID:
ZDB-GENE-081105-16
Description:
Novel protein similar to vertebrate phosphodiesterase 4D, cAMP-specific (Phosphodiesterase E3 dunce
Human Orthologue:
PDE4D
Human Description:
phosphodiesterase 4D, cAMP-specific [Source:HGNC Symbol;Acc:8783]
Mouse Orthologue:
Pde4d
Mouse Description:
phosphodiesterase 4D, cAMP specific Gene [Source:MGI Symbol;Acc:MGI:99555]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa117 Nonsense Confirmed mutation in F2 line During 2017
sa18915 Nonsense Mutation detected in F1 DNA During 2017
sa9416 Nonsense Available for shipment Available now
sa14598 Nonsense Available for shipment Available now
sa41163 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa117
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018934 Nonsense 380 725 11 17
ENSDART00000139452 Nonsense 289 665 9 14
Genomic Location (Zv9):
Chromosome 8 (position 17554468)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16999356
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTAACAAGGTACTTCTGTGCTGTAGGAGAGGGACTTGTTAAAGACGTTT[A/T]AAATTCCCCTCGACACGTTTATCACCTATCTGATGACTTTAGAGGACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18915
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018934 Nonsense 389 725 11 17
ENSDART00000139452 Nonsense 298 665 9 14
ENSDART00000018934 Nonsense 389 725 11 17
ENSDART00000139452 Nonsense 298 665 9 14
Genomic Location (Zv9):
Chromosome 8 (position 17554497)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16999385
KASP Assay ID:
2260-0359.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGACTTGTTAAAGACGTTTAAAATTCCCCTCGACACGTTTATCACCTA[T/A]CTGATGACTTTAGAGGACCATTATCATGCTGACGTTGCCTATCACAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9416
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018934 Nonsense 389 725 11 17
ENSDART00000139452 Nonsense 298 665 9 14
ENSDART00000018934 Nonsense 389 725 11 17
ENSDART00000139452 Nonsense 298 665 9 14
Genomic Location (Zv9):
Chromosome 8 (position 17554497)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16999385
KASP Assay ID:
2260-0359.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGACTTGTTAAAGACGTTTAAAATTCCCCTCGACACGTTTATCACCTA[T/A]CTGATGACTTTAGAGGAYCATTATCATGCYGACGTTGCCTATCACAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14598
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018934 Nonsense 490 725 13 17
ENSDART00000139452 Nonsense 399 665 11 14
Genomic Location (Zv9):
Chromosome 8 (position 17558549)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17003437
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAATCATCATCTAGCTGTTGGCTTTAAGCTGCTTCAGGARGAAAACTG[T/A]GACATCTTCCAGAACCTGACCAAGAAACAGAGACAGTCGCTCCGCAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41163
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018934 Nonsense 649 725 16 17
ENSDART00000139452 Nonsense 558 665 14 14
Genomic Location (Zv9):
Chromosome 8 (position 17563733)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17008621
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCCAGATGCTCAGGACATCCTGGACACGCTGGAGGACAACAGAGAGTG[G/A]TACCAGAGCACCATCCCGCAGAGCCCGTCTCCAGCACTGGACACCAGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link