si:dkey-11p23.7

Ensembl ID:
ENSDARG00000032743
ZFIN ID:
ZDB-GENE-100922-120
Description:
sialic acid-binding Ig-like lectin 15 [Source:RefSeq peptide;Acc:NP_001095865]
Human Orthologue:
SIGLEC15
Human Description:
sialic acid binding Ig-like lectin 15 [Source:HGNC Symbol;Acc:27596]
Mouse Orthologue:
Siglec15
Mouse Description:
sialic acid binding Ig-like lectin 15 Gene [Source:MGI Symbol;Acc:MGI:3646642]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22922 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22922
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049976 Nonsense 29 287 2 3
Genomic Location (Zv9):
Chromosome 16 (position 44286841)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41567349
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTCTAAACTTTTTTCATTCAGCTGTGGCCAAAGATGATGATGGCTGGT[T/A]AATGAAGGCTCCCGCTGAGGTGCGGGGGATAGAGGGTTACCCGGTGGTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link