gria3a

Ensembl ID:
ENSDARG00000032737
ZFIN ID:
ZDB-GENE-020125-5
Description:
glutamate receptor, ionotropic, AMPA 3a [Source:RefSeq peptide;Acc:NP_938153]
Human Orthologue:
GRIA3
Human Description:
glutamate receptor, ionotrophic, AMPA 3 [Source:HGNC Symbol;Acc:4573]
Mouse Orthologue:
Gria3
Mouse Description:
glutamate receptor, ionotropic, AMPA3 (alpha 3) Gene [Source:MGI Symbol;Acc:MGI:95810]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11259 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11259
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049291 Nonsense 206 886 4 15
ENSDART00000137120 None None 119 None 3

The following transcripts of ENSDARG00000032737 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 25077261)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGTAGATCCTCTTGAATACAGGCGCATTATTGAAGAAATGGATCGTCGC[C/T]AGGAGAAACGTTTCCTTATCGACTGTGAAGTTGAGCGCATTAACAGTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h4f6wfvy