gria1b

Ensembl ID:
ENSDARG00000032714
ZFIN ID:
ZDB-GENE-020125-2
Description:
glutamate receptor, ionotropic, AMPA 1b [Source:RefSeq peptide;Acc:NP_991293]
Human Orthologue:
GRIA1
Human Description:
glutamate receptor, ionotropic, AMPA 1 [Source:HGNC Symbol;Acc:4571]
Mouse Orthologue:
Gria1
Mouse Description:
glutamate receptor, ionotropic, AMPA1 (alpha 1) Gene [Source:MGI Symbol;Acc:MGI:95808]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39331 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39331
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044735 Nonsense 805 917 14 16
ENSDART00000123713   None 917 None 16
ENSDART00000129703 Nonsense 806 930 15 19
ENSDART00000134761   None 155 None 4
Genomic Location (Zv9):
Chromosome 21 (position 25555429)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26125247
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGTTAAAACTGAACGAGCAGGGCCTGTTGGACAAATTGAAAAACAAAT[G/A]GTGGTACGACAAGGGAGAGTGTGGCAGCGGAGGAGGTGATTCCAAGGTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link