foxg1b

Ensembl ID:
ENSDARG00000032705
ZFIN ID:
ZDB-GENE-040426-2437
Description:
forkhead box G1b [Source:RefSeq peptide;Acc:NP_998079]
Human Orthologue:
FOXG1
Human Description:
forkhead box G1 [Source:HGNC Symbol;Acc:3811]
Mouse Orthologues:
3110039M20Rik, Foxg1
Mouse Descriptions:
forkhead box G1 Gene [Source:MGI Symbol;Acc:MGI:1347464]
RIKEN cDNA 3110039M20 gene Gene [Source:MGI Symbol;Acc:MGI:1914543]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2593 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2593
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013642 Nonsense 197 333 1 1
Genomic Location:
Chromosome 11 (position 44268590)
KASP Assay ID:
554-2714.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCRCCGCTCGGACTCGGTCTGGGCGAGCGCCCGAGCAACCCGTTGTACT[G/A]GCAGCTGTCTCCGTTTTTACCACTGCACCACTCGCATTACAACGGCTCCG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xx91x104