qrsl1

Ensembl ID:
ENSDARG00000032704
ZFIN ID:
ZDB-GENE-030131-5540
Description:
glutamyl-tRNA(Gln) amidotransferase subunit A homolog [Source:RefSeq peptide;Acc:NP_001112370]
Human Orthologue:
QRSL1
Human Description:
glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1 [Source:HGNC Symbol;Acc:21020]
Mouse Orthologue:
Qrsl1
Mouse Description:
glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1 Gene [Source:MGI Symbol;Acc:MGI:1923813]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9655 Nonsense Available for shipment Available now
sa11123 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9655
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045615 Nonsense 109 536 4 11

The following transcripts of ENSDARG00000032704 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 25406876)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25546795
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGRTTGTGACATGTTTGATTCCCATTATCKGTTTGGATTGGTAGGTTA[T/A]GTTCCTCCATTCAGTGCTACAGTTGTGCAGAAGCTGTTGGATCARGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11123
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045615 Nonsense 504 536 11 11

The following transcripts of ENSDARG00000032704 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 25417293)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25557212
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACACTACAAGACTGGAAATTGTTGACAATCGCCCACTGGATGGAGAAA[C/T]AACTCCACTTCCCAATGATCCGATTCCACRGGGACTTAAATGAAAATGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link