fam60a

Ensembl ID:
ENSDARG00000032653
ZFIN ID:
ZDB-GENE-041210-166
Description:
family with sequence similarity 60, member A [Source:RefSeq peptide;Acc:NP_001020702]
Human Orthologue:
FAM60A
Human Description:
family with sequence similarity 60, member A [Source:HGNC Symbol;Acc:30702]
Mouse Orthologue:
Fam60a
Mouse Description:
family with sequence similarity 60, member A Gene [Source:MGI Symbol;Acc:MGI:1929091]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33435 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33435
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042307 Essential Splice Site 118 245 4 6
ENSDART00000126608 Essential Splice Site 118 245 3 5
Genomic Location (Zv9):
Chromosome 4 (position 15706428)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16649268
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCGACCGAGCCAGATCAGCAGAGTTCAGAAAGAACTCAAGAGACACAG[T/A]GAGTCAAAAAAAACTCGTATTTCAGTTACAAATGAACCTGAAAGTGCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link