FUK

Ensembl ID:
ENSDARG00000032650
Description:
fucokinase [Source:HGNC Symbol;Acc:29500]
Human Orthologue:
FUK
Human Description:
fucokinase [Source:HGNC Symbol;Acc:29500]
Mouse Orthologue:
Fuk
Mouse Description:
fucokinase Gene [Source:MGI Symbol;Acc:MGI:1916071]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24603 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24603
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042928 Nonsense 134 602 2 11
Genomic Location:
Chromosome 25 (position 7845656)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCAAACAGCAGTGGTGATCTGGGAGTAGCGGCCCGCTGTCTGGCCTG[T/A]ATCGCGGATGTTCTTGGCTGTCTGGCTGGTGAAGGGAAAGGTGGTTTGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kcicd02i