si:ch211-244b2.1

Ensembl ID:
ENSDARG00000032627
ZFIN ID:
ZDB-GENE-041210-205
Description:
hypothetical protein LOC557149 [Source:RefSeq peptide;Acc:NP_001074268]
Human Orthologue:
SCYL2
Human Description:
SCY1-like 2 (S. cerevisiae) [Source:HGNC Symbol;Acc:19286]
Mouse Orthologue:
Scyl2
Mouse Description:
SCY1-like 2 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1289172]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20292 Nonsense Available for shipment Available now
sa20293 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20292
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039877 Nonsense 97 929 2 17
Genomic Location (Zv9):
Chromosome 4 (position 25145568)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 26069237
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAGATTATCGATTCACTGAAGAAAGGAATTCAACAGCTTACCAGATTA[C/T]GACATCCACGTCTCCTGACGGTTCAGCACCCGCTTGAAGAGTCCAGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20293
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039877 Essential Splice Site 323 929 6 17
Genomic Location (Zv9):
Chromosome 4 (position 25154572)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 26078241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCAGCGTCACCTCCAACGTGCGTCCAGACGCAGACCAGATGACAAAGG[T/G]CAGATCTTTCCCTCCTTACTGCTGTTTTTCCAGGGATTTTTTTGTTTGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Squamous cell carcinoma: Genome-wide association study identifies a novel susceptibility locus at 12q23.1 for lung squamous cell carcinoma in han chinese. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link