fgfrl1a

Ensembl ID:
ENSDARG00000032617
ZFIN ID:
ZDB-GENE-040128-2
Description:
alpha-L-iduronidase [Source:RefSeq peptide;Acc:NP_956670]
Human Orthologue:
FGFRL1
Human Description:
fibroblast growth factor receptor-like 1 [Source:HGNC Symbol;Acc:3693]
Mouse Orthologue:
Fgfrl1
Mouse Description:
fibroblast growth factor receptor-like 1 Gene [Source:MGI Symbol;Acc:MGI:2150920]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu3328 Nonsense Available for shipment Available now
sa14717 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
hu3328
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082667 Nonsense 314 483 6 7
ENSDART00000147149   None 112 None 3
Genomic Location (Zv9):
Chromosome 14 (position 15280075)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 17142061
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTGTGTTGCCCACGGGTGACGTGTGGTCACGACCTGACGGCTCTTATT[T/A]GAACAAACTGCTGATCACTCGAGCCAAGGAGGAGGACGCCGGCATGTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14717
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082667 Nonsense 435 483 7 7
ENSDART00000147149   None 112 None 3
Genomic Location (Zv9):
Chromosome 14 (position 15276634)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 17138620
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCGACCGGCYGATAAAGACTGCATCGCCTCAGTCGCCTACGAGGAGTA[T/A]CTGGCCCAACAGCAGCAACAGCAGCTCCTGCTGGCTCAATCGGCTCCTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link