fgfrl1a

Ensembl ID:
ENSDARG00000032617
ZFIN ID:
ZDB-GENE-040128-2
Description:
alpha-L-iduronidase [Source:RefSeq peptide;Acc:NP_956670]
Human Orthologue:
FGFRL1
Human Description:
fibroblast growth factor receptor-like 1 [Source:HGNC Symbol;Acc:3693]
Mouse Orthologue:
Fgfrl1
Mouse Description:
fibroblast growth factor receptor-like 1 Gene [Source:MGI Symbol;Acc:MGI:2150920]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3901 Essential Splice Site Mutation detected in F1 DNA During 2014
hu3328 Nonsense Confirmed mutation in F2 line Unknown
sa14717 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3901
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082667 Essential Splice Site 113 483 None 7
ENSDART00000147149 None 113 112 None 3
Genomic Location:
Chromosome 14 (position 15333506)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACSAATGGATTYGGCAGTGTCAATATCAACTACACCCTCATCGTCATTGG[T/G]AAGTGTATTTTGAATTAAATCTAGTGAGTCTTCTTCATTAGTAGCTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3328
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082667 Nonsense 314 483 6 7
ENSDART00000147149 None None 112 None 3
Genomic Location:
Chromosome 14 (position 15280075)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTGTGTTGCCCACGGGTGACGTGTGGTCACGACCTGACGGCTCTTATT[T/A]GAACAAACTGCTGATCACTCGAGCCAAGGAGGAGGACGCCGGCATGTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14717
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082667 Nonsense 435 483 7 7
ENSDART00000147149 None None 112 None 3
Genomic Location:
Chromosome 14 (position 15276634)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCGACCGGCYGATAAAGACTGCATCGCCTCAGTCGCCTACGAGGAGTA[T/A]CTGGCCCAACAGCAGCAACAGCAGCTCCTGCTGGCTCAATCGGCTCCTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yh5tei8u