sept8a

Ensembl ID:
ENSDARG00000032606
ZFIN ID:
ZDB-GENE-030131-309
Description:
Septin-8-A [Source:UniProtKB/Swiss-Prot;Acc:Q642H3]
Human Orthologue:
SEPT8
Human Description:
septin 8 [Source:HGNC Symbol;Acc:16511]
Mouse Orthologue:
Sept8
Mouse Description:
septin 8 Gene [Source:MGI Symbol;Acc:MGI:894310]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37378 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37378
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045144 Essential Splice Site 420 420 10 10
ENSDART00000109620 Essential Splice Site 420 420 10 10
ENSDART00000139668   None 190 None 6
Genomic Location (Zv9):
Chromosome 21 (position 41780029)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 43379075
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCGTTGATACTCATTTTCCTGTTTTGTGTTTGTTTGTTTTTTCTTTCA[G/A]TTAATTTATGAGCACATCGCAGGCCATCCATGGACTTTCCTTCATTACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link