pax2b

Ensembl ID:
ENSDARG00000032578
ZFIN ID:
ZDB-GENE-001030-4
Description:
paired box gene 2b [Source:RefSeq peptide;Acc:NP_571715]
Human Orthologue:
PAX2
Human Description:
paired box 2 [Source:HGNC Symbol;Acc:8616]
Mouse Orthologue:
Pax2
Mouse Description:
paired box gene 2 Gene [Source:MGI Symbol;Acc:MGI:97486]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10953 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10953
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043210 Essential Splice Site 136 386 3 10
Genomic Location (Zv9):
Chromosome 12 (position 46824044)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 45710469
KASP Assay ID:
2260-5748.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGGCATCTGTGATAACGACACCGTCCCCAGTGTCTCCTCCATAAACWG[G/A]TCAGCTCAACTATAYCCACTTTAGCTACTTTATTTTTCTAGTGGCATGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link