clcn6

Ensembl ID:
ENSDARG00000032577
ZFIN ID:
ZDB-GENE-030131-2056
Human Orthologue:
CLCN6
Human Description:
chloride channel 6 [Source:HGNC Symbol;Acc:2024]
Mouse Orthologue:
Clcn6
Mouse Description:
chloride channel 6 Gene [Source:MGI Symbol;Acc:MGI:1347049]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16118 Nonsense Available for shipment Available now
sa5777 Nonsense F2 line generated During 2014
sa2420 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa16118
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047134 Nonsense 816 863 22 23
Genomic Location:
Chromosome 8 (position 50792388)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTACATGAACCCCTGYCCRTATACAGTCTCTCCAAACACACAYGTCTCC[C/T]AAGTATTCAATCTTTTCAGRACTATGGGGCTTCGACACTTACCTGTAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5777
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047134 Nonsense 858 863 23 23
ENSDART00000047134 Nonsense 858 863 23 23
Genomic Location:
Chromosome 8 (position 50788804)
KASP Assay ID:
554-2626.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATCACCAGGCATAATCTTACCCATGAGTTTTTAGTCGCTAAACTCCGA[C/T]AGCATTACATCACRATATAAGACTCCACTGGCACCGTCTGCCATCAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2420
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047134 Nonsense 858 863 23 23
ENSDART00000047134 Nonsense 858 863 23 23
Genomic Location:
Chromosome 8 (position 50788804)
KASP Assay ID:
554-2626.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATCACCAGGCATAATCTTACCCATGAGTTTTTAGTCGCTAAACTCCGA[C/T]AGCATTACATCACRATATAAGACTCCACTGGCACCGTCTGCCATCAAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s8abli7t