march5

Ensembl ID:
ENSDARG00000032552
ZFIN ID:
ZDB-GENE-070424-47
Description:
E3 ubiquitin-protein ligase MARCH5 [Source:RefSeq peptide;Acc:NP_001076296]
Human Orthologue:
MARCH5
Human Description:
membrane-associated ring finger (C3HC4) 5 [Source:HGNC Symbol;Acc:26025]
Mouse Orthologue:
March5
Mouse Description:
membrane-associated ring finger (C3HC4) 5 Gene [Source:MGI Symbol;Acc:MGI:1915207]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38969 Nonsense Mutation detected in F1 DNA During 2017
sa28189 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38969
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043069 Nonsense 81 281 2 6
Genomic Location (Zv9):
Chromosome 13 (position 43031490)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42252449
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGGGTCGCCTGCCCACAATGCAATGCCGAGTACCTCATTGTGTTCCCT[A/T]AGCTTGGTACGTCAAGTATAAGTGGGTCGATTGTGTCTTGTTTTTATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28189
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043069 Essential Splice Site 83 281 3 6
Genomic Location (Zv9):
Chromosome 13 (position 43018403)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 42239362
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGTTCATGCAGACTTTAAAGGCGGAGTGTGTGTGTGTTTTTGTGTGC[A/T]GGGCCGGTGGTGTATGTGCTGGACCTGGCAGACAGGTTGATCTCGAAGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link