praf2

Ensembl ID:
ENSDARG00000032535
ZFIN ID:
ZDB-GENE-050417-190
Description:
PRA1 family protein 2 [Source:RefSeq peptide;Acc:NP_001017698]
Human Orthologues:
AF196779.12, PRAF2
Human Descriptions:
PRA1 domain family, member 2 [Source:HGNC Symbol;Acc:28911]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A6NM71]
Mouse Orthologue:
Praf2
Mouse Description:
PRA1 domain family 2 Gene [Source:MGI Symbol;Acc:MGI:1859607]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8997 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8997
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040804 Nonsense 21 178 1 3
Genomic Location (Zv9):
Chromosome 8 (position 46635147)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 44910722
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYCAACCTCCCCCGCTCAGAACCTTGGACGATTTTCTGCTAAGTTCGGCT[C/T]GATTTTCAYTGCCTGATGTTCGTAACCYAGATCGATGGAATAACCGGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link