efna3b

Ensembl ID:
ENSDARG00000032485
ZFIN ID:
ZDB-GENE-011108-1
Description:
ephrin A3b [Source:RefSeq peptide;Acc:NP_571929]
Human Orthologues:
EFNA3, RP11-540D14.8
Human Descriptions:
cDNA FLJ57652, highly similar to Ephrin-A3 [Source:UniProtKB/TrEMBL;Acc:B4DXG7]
ephrin-A3 [Source:HGNC Symbol;Acc:3223]
Mouse Orthologue:
Efna3
Mouse Description:
ephrin A3 Gene [Source:MGI Symbol;Acc:MGI:106644]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22828 Nonsense Mutation detected in F1 DNA During 2014
sa14686 Nonsense Available for shipment Available now
sa10600 Nonsense Available for shipment Available now
sa2851 Nonsense F2 line generated During 2014
sa25013 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22828
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103229 Nonsense 8 195 1 6
ENSDART00000121607 None None 219 None 5
ENSDART00000146159 None None 64 None 3
Genomic Location:
Chromosome 16 (position 25409935)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTGATTTTCACAAATTCTCAGAAACAAGCATAGCTTACATTGGCAAT[C/G]AATCCACCAGTAAGCCTTTGTCCTTAATTGACCTACAGTATGTTTTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14686
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103229 Nonsense 27 195 3 6
ENSDART00000121607 Nonsense 51 219 2 5
ENSDART00000146159 None None 64 None 3
ENSDART00000103229 Nonsense 27 195 3 6
ENSDART00000121607 Nonsense 51 219 2 5
ENSDART00000146159 None None 64 None 3
Genomic Location:
Chromosome 16 (position 25411783)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAGACTTCGTAAGGAGGGCTACACGTTGCAGGTGAATGTCAACGACTA[T/G]CTGGACATCTACTGTCCTCACTACAACAGCAGTCAGAGGGGCATCGCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10600
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103229 Nonsense 27 195 3 6
ENSDART00000121607 Nonsense 51 219 2 5
ENSDART00000146159 None None 64 None 3
ENSDART00000103229 Nonsense 27 195 3 6
ENSDART00000121607 Nonsense 51 219 2 5
ENSDART00000146159 None None 64 None 3
Genomic Location:
Chromosome 16 (position 25411783)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAGACTTCGTAAGGAGGGCTACACGTTGCAGGTGAATGTCAACGACTA[T/A]CTGGACATCTACTGTCCTCACTACAACAGCAGTCAGAGGGGCATCGCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2851
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103229 Nonsense 46 195 3 6
ENSDART00000121607 Nonsense 70 219 2 5
ENSDART00000146159 None None 64 None 3
Genomic Location:
Chromosome 16 (position 25411840)
KASP Assay ID:
554-2893.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTACTGTCCTCACTACAACAGCAGTCAGAGGGGCATCGCGGAACAGTA[T/A]GTGCTCTACATGGTCAGTTATCGCGGTTACCGGACCTGTGATCCACAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25013
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103229 Nonsense 70 195 3 6
ENSDART00000121607 Nonsense 94 219 2 5
ENSDART00000146159 None None 64 None 3
Genomic Location:
Chromosome 16 (position 25411912)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCGGTTACCGGACCTGTGATCCACAGCTAGGCTTCAAGCGCTGGGAGTG[T/A]AACCGTCCTCACGCCCCTCATGCTCCCATCAAATTCTCAGAGAAGTTCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zn5tmjie