med24

Ensembl ID:
ENSDARG00000032459
ZFIN ID:
ZDB-GENE-030131-2341
Description:
Mediator of RNA polymerase II transcription subunit 24 [Source:UniProtKB/Swiss-Prot;Acc:Q2PW47]
Human Orthologue:
MED24
Human Description:
mediator complex subunit 24 [Source:HGNC Symbol;Acc:22963]
Mouse Orthologue:
Med24
Mouse Description:
mediator complex subunit 24 Gene [Source:MGI Symbol;Acc:MGI:1344385]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3811 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3811
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106375 Nonsense 215 988 6 26
Genomic Location:
Chromosome 12 (position 8850718)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCTCAGTGCTGTGAMCAATCCAACTCTGAAGGAAAGTCTTGAGGAGTG[T/A]GTTTCATTGGTCAAAAGGTGAGAACCCCAAAAAACTTCAGACCCACCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ne6hma73