mark2

Ensembl ID:
ENSDARG00000032458
ZFIN ID:
ZDB-GENE-080215-4
Human Orthologue:
MARK2
Human Description:
MAP/microtubule affinity-regulating kinase 2 [Source:HGNC Symbol;Acc:3332]
Mouse Orthologue:
Mark2
Mouse Description:
MAP/microtubule affinity-regulating kinase 2 Gene [Source:MGI Symbol;Acc:MGI:99638]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9740 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9740
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005329 Nonsense 164 788 7 19
Genomic Location:
Chromosome 7 (position 26104507)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTTCTCTYTTTATCTCTCCAGATTGTCTCAGCTGTGCAGTATTGCCAT[C/T]AGAAGTGTATTGTACACCGAGATCTCAAGGTGAGAATTTGTTTCTGTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wu1po08d