mpv17

Ensembl ID:
ENSDARG00000032431
ZFIN ID:
ZDB-GENE-040426-1168
Description:
Protein Mpv17 [Source:UniProtKB/Swiss-Prot;Acc:Q5TZ51]
Human Orthologue:
MPV17
Human Description:
MpV17 mitochondrial inner membrane protein [Source:HGNC Symbol;Acc:7224]
Mouse Orthologue:
Mpv17
Mouse Description:
MpV17 mitochondrial inner membrane protein Gene [Source:MGI Symbol;Acc:MGI:97138]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39299 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39299
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044665 Essential Splice Site 94 177 3 7
ENSDART00000146544 Essential Splice Site 94 177 4 8
Genomic Location (Zv9):
Chromosome 20 (position 38722705)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38795117
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACAGGCGGTACTAAAAGTGCAGCTCTGAAGAAAATGCTTGTTGACCAG[G/A]TGGGCCACAAACAGATCACAAATTGATTTTTATTTTATTTGATTAATAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link