ppp2r1b

Ensembl ID:
ENSDARG00000032430
ZFIN ID:
ZDB-GENE-040927-20
Description:
serine/threonine-protein phosphatase 2A 65 kDa regulatory subunit A beta isoform [Source:RefSeq pep
Human Orthologue:
PPP2R1B
Human Description:
protein phosphatase 2, regulatory subunit A, beta [Source:HGNC Symbol;Acc:9303]
Mouse Orthologue:
Ppp2r1b
Mouse Description:
protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), beta isoform Gene [Source:MGI Sym

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39041 Nonsense Mutation detected in F1 DNA During 2017
sa13079 Nonsense Available for shipment Available now
sa35873 Nonsense Available for shipment Available now
sa22634 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39041
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016860 Nonsense 200 589 5 15

The following transcripts of ENSDARG00000032430 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 20710167)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21812793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCTGCCTCCAAGCTTGGCGAGTTTGCCAAGGTTTTGGAGCTGGATTA[T/A]GTTAAGAGTGACATCATTCCTCTCTTTACAGCGCTGGCCTCTGATGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13079
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016860 Nonsense 291 589 7 15

The following transcripts of ENSDARG00000032430 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 20712584)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21815210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCCCAGAGATCACCAAGAACGATCTGGTCCCTGCGTTCCAGAACTTGT[T/A]GAAAGATTGCGAGGYAGAGGTCCGAGCCGCTGCTGCCAACAAGGTGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35873
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016860 Nonsense 294 589 7 15

The following transcripts of ENSDARG00000032430 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 20712594)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21815220
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCACCAAGAACGATCTGGTCCCTGCGTTCCAGAACTTGTTGAAAGATTG[C/A]GAGGCAGAGGTCCGAGCCGCTGCTGCCAACAAGGTGAAAGGTGAGGCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22634
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016860 Essential Splice Site 331 589 8 15

The following transcripts of ENSDARG00000032430 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 20712802)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 21815428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGACAGCAGGGAGACCATCATCATGACTCACATACTGCCATGCGTCAAG[G/A]TACACATTTTAATCTCGATCCACTTGTTTCTGAAATTGCGTGTGGCTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link