tspan12

Ensembl ID:
ENSDARG00000032389
ZFIN ID:
ZDB-GENE-040426-1285
Description:
tetraspanin-12 [Source:RefSeq peptide;Acc:NP_957446]
Human Orthologue:
TSPAN12
Human Description:
tetraspanin 12 [Source:HGNC Symbol;Acc:21641]
Mouse Orthologue:
Tspan12
Mouse Description:
tetraspanin 12 Gene [Source:MGI Symbol;Acc:MGI:1889818]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20220 Nonsense Available for shipment Available now
sa33401 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20220
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048003 Nonsense 9 301 2 8
Genomic Location (Zv9):
Chromosome 4 (position 9662266)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10598893
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCGAGCAGTTGGTGCGCTCAGAATGGCCCGGGAGGATTCGGTGAAATG[T/A]CTGCGCTGTCTGCTCTACGCGCTCAACTTTCTCTTCTGGGTAAGACGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33401
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048003 Nonsense 150 301 6 8
Genomic Location (Zv9):
Chromosome 4 (position 9647182)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10583809
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTTTGGCCTGCAGCGTTACCAGTGGCTGACACACGCCTGGAATGCTT[T/A]ACAGACAGAGGTGAGAGGGCAAAATCACCAGGATGGCACCTTGTCACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link