LOC569740

Ensembl ID:
ENSDARG00000032372
Human Orthologue:
C9orf174
Human Description:
chromosome 9 open reading frame 174 [Source:HGNC Symbol;Acc:29303]
Mouse Orthologue:
E230008N13Rik
Mouse Description:
RIKEN cDNA E230008N13 gene Gene [Source:MGI Symbol;Acc:MGI:2685871]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14782 Nonsense Available for shipment Available now
sa3553 Nonsense Mutation detected in F1 DNA During 2016
sa31476 Missense, Nonsense Mutation detected in F1 DNA During 2016
sa7004 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33713 Nonsense Mutation detected in F1 DNA During 2016
sa40557 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33712 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38503 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14782
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042420   None 1336 None 34
ENSDART00000111120   None 313 None 9
ENSDART00000130660 Nonsense 471 1502 15 39
Genomic Location:
Chromosome 5 (position 52830916)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTAMAATTTCACTCTTTSACATGTTYACTGAACATAGATANNNNNTGT[C/T]AAWTGTCTCACCCAACAGAGGAAAGAGGCCCAGCTGGATATGATGTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3553
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042420   None 1336 None 34
ENSDART00000111120   None 313 None 9
ENSDART00000130660 Nonsense 471 1502 15 39
Genomic Location:
Chromosome 5 (position 52830916)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTAAAATTTCACTCTTTSACATGTTCACTGAACATAGATANNNNNTGT[C/T]AAATGTCTCACCCAACAGAGGAAAGAGGCCCAGCTGGATATGATGTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31476
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042420 Nonsense 403 1336 11 34
ENSDART00000111120   None 313 None 9
ENSDART00000130660 Missense 492 1502 15 39
Genomic Location:
Chromosome 5 (position 52830852)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGAGGAAAGAGGCCCAGCTGGATATGATGTTGGACAAACTCAGACAG[G/T]AAAGTTCAGAAGAAGCTCTGAAGGCCTCATTAGAGAAAATACTAACCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7004
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042420 Essential Splice Site 467 1336 None 34
ENSDART00000111120   None 313 None 9
ENSDART00000130660   562 1502 16 39
Genomic Location:
Chromosome 5 (position 52830506)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATACAGTSTTTYTGTTAGCCAGTTCTTYRGTGCTGAAGAGGTTTATGG[T/G]CRGGTACATATTTAACAWGAACAATGCTGTTATCTCTGTTTGTACTTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33713
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042420 Nonsense 726 1336 18 34
ENSDART00000111120   None 313 None 9
ENSDART00000130660 Nonsense 877 1502 23 39
Genomic Location:
Chromosome 5 (position 52827469)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTGAGGGGGGGAATTTTACACCCCAGGAAATTGAGGTCTTTCAGTCA[C/T]AACTGGAAAAGATGGACAAGCGCATTGATACCGCAGAGGGGGCCGTGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40557
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042420 Essential Splice Site 1002 1336 26 34
ENSDART00000111120   None 313 None 9
ENSDART00000130660 Essential Splice Site 1168 1502 31 39
Genomic Location:
Chromosome 5 (position 52822163)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGAAGTACCTTATTTTTGGCTCCAACCCCGAAGAGCAGAAGAACAGG[T/C]AAGTGCAACTGTGGTACTTATATATGATATGTTTTGCTTTGTTAATTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33712
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042420 Essential Splice Site 1210 1336 31 34
ENSDART00000111120   None 313 None 9
ENSDART00000130660 Essential Splice Site 1376 1502 36 39
ENSDART00000042420 Essential Splice Site 1210 1336 31 34
ENSDART00000111120   None 313 None 9
ENSDART00000130660 Essential Splice Site 1376 1502 36 39
Genomic Location:
Chromosome 5 (position 52819422)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATTTCAGTTCGACAATCTCATTACCATCCATGAGGTTCAAGTGGGACG[T/A]AAGTCTATGTGGTTACACTATGGGAATGTAAAATGATGCCTCACCACCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38503
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042420 Essential Splice Site 1210 1336 31 34
ENSDART00000111120   None 313 None 9
ENSDART00000130660 Essential Splice Site 1376 1502 36 39
ENSDART00000042420 Essential Splice Site 1210 1336 31 34
ENSDART00000111120   None 313 None 9
ENSDART00000130660 Essential Splice Site 1376 1502 36 39
Genomic Location:
Chromosome 5 (position 52819422)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATTTCAGTTCGACAATCTCATTACCATCCATGAGGTTCAAGTGGGACG[T/A]AAGTCTATGTGGTTACACTATGGGAATGTAAAATGATGCCTCACCACCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link