LOC569740

Ensembl ID:
ENSDARG00000032372
Human Orthologue:
C9orf174
Human Description:
chromosome 9 open reading frame 174 [Source:HGNC Symbol;Acc:29303]
Mouse Orthologue:
E230008N13Rik
Mouse Description:
RIKEN cDNA E230008N13 gene Gene [Source:MGI Symbol;Acc:MGI:2685871]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14782 Nonsense Available for shipment Available now
sa3553 Nonsense Mutation detected in F1 DNA During 2014
sa7004 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14782
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042420 None None 1336 None 34
ENSDART00000111120 None None 313 None 9
ENSDART00000130660 Nonsense 471 1502 15 39
Genomic Location:
Chromosome 5 (position 52830916)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTAMAATTTCACTCTTTSACATGTTYACTGAACATAGATANNNNNTGT[C/T]AAWTGTCTCACCCAACAGAGGAAAGAGGCCCAGCTGGATATGATGTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3553
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042420 None None 1336 None 34
ENSDART00000111120 None None 313 None 9
ENSDART00000130660 Nonsense 471 1502 15 39
Genomic Location:
Chromosome 5 (position 52830916)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTAAAATTTCACTCTTTSACATGTTCACTGAACATAGATANNNNNTGT[C/T]AAATGTCTCACCCAACAGAGGAAAGAGGCCCAGCTGGATATGATGTTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7004
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042420 Essential Splice Site 467 1336 None 34
ENSDART00000111120 None None 313 None 9
ENSDART00000130660 None 562 1502 16 39
Genomic Location:
Chromosome 5 (position 52830506)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATACAGTSTTTYTGTTAGCCAGTTCTTYRGTGCTGAAGAGGTTTATGG[T/G]CRGGTACATATTTAACAWGAACAATGCTGTTATCTCTGTTTGTACTTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z3d54tmj