serhl

Ensembl ID:
ENSDARG00000032340
ZFIN ID:
ZDB-GENE-030131-1368
Description:
Serine hydrolase-like protein [Source:UniProtKB/Swiss-Prot;Acc:A2BGU9]
Human Orthologue:
SERHL2
Human Description:
serine hydrolase-like 2 [Source:HGNC Symbol;Acc:29446]
Mouse Orthologue:
Serhl
Mouse Description:
serine hydrolase-like Gene [Source:MGI Symbol;Acc:MGI:1890404]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30586 Essential Splice Site Mutation detected in F1 DNA During 2017
sa19557 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30586
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042158 Essential Splice Site 68 326 4 13

The following transcripts of ENSDARG00000032340 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 46132670)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44970182
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTAGTGAAAATGCTTCTCATTCTCTCTGTATTTCTCTGCATCTCTCCCA[G/A]ACTGGAGATTTGTAGCCATTGATTTTCCAGGTCATGGTCTCTCATCTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19557
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042158 Nonsense 102 326 4 13

The following transcripts of ENSDARG00000032340 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 46132568)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44970080
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCTGATGGATGCTTTTACGCCTTCCCTTTTTATGTGGCCGATGTTCGA[C/T]GAGTTGTTGAAGGTTTGAAGAAACTCTGTTTTTGTTTCTAATCAACTAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link