epb41l5

Ensembl ID:
ENSDARG00000032324
ZFIN ID:
ZDB-GENE-030616-450
Description:
erythrocyte membrane protein band 4.1 like 5 [Source:RefSeq peptide;Acc:NP_956383]
Human Orthologue:
EPB41L5
Human Description:
erythrocyte membrane protein band 4.1 like 5 [Source:HGNC Symbol;Acc:19819]
Mouse Orthologue:
Epb4.1l5
Mouse Description:
erythrocyte protein band 4.1-like 5 Gene [Source:MGI Symbol;Acc:MGI:103006]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2498 Nonsense F2 line generated During 2014
sa7186 Nonsense Mutation detected in F1 DNA During 2014
sa9677 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2498
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060315 Nonsense 349 445 13 17
ENSDART00000101215 None None 218 13 25
ENSDART00000101269 Nonsense 353 776 13 26
ENSDART00000101276 Nonsense 360 772 13 26
ENSDART00000132878 Nonsense 353 776 12 25
ENSDART00000135334 Nonsense 360 461 13 17
Genomic Location:
Chromosome 9 (position 29935255)
KASP Assay ID:
554-2890.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACATAGATGTTTTTTNCCCTTTATTTGTGTAAAGTGGGAAGACAGAATA[T/A]CAGACAACAAAGGCAAACAAAGCTAGAAGGTCTGCCTCCTTTGAAAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7186
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060315 None None 445 None 17
ENSDART00000101215 Nonsense 178 218 24 25
ENSDART00000101269 Nonsense 736 776 25 26
ENSDART00000101276 Nonsense 732 772 25 26
ENSDART00000132878 Nonsense 736 776 24 25
ENSDART00000135334 None None 461 None 17
Genomic Location:
Chromosome 9 (position 29908636)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACTAACGGCCTCCTCGACTGTCCCACAAAGGTGTCATCTCACCATCCT[G/T]AGGGCTCTRTTTCCCCTCTTCCTCAGCTCTCTCAAACTCACAATGTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9677
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060315 None None 445 None 17
ENSDART00000101215 Nonsense 211 218 25 25
ENSDART00000101269 Nonsense 769 776 26 26
ENSDART00000101276 Nonsense 765 772 26 26
ENSDART00000132878 Nonsense 769 776 25 25
ENSDART00000135334 None None 461 None 17
Genomic Location:
Chromosome 9 (position 29905621)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTGACAGCATTGTGGCTCAYTCGACCAAGGACAACAACCACAAGCCC[A/T]AAGGTCTACTGACCACTGAACTCTGAAAGCGATGCCTCAAGCACATGCCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast size: Genetic variants associated with breast size also influence breast cancer risk. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s2sdariz