mest

Ensembl ID:
ENSDARG00000032319
ZFIN ID:
ZDB-GENE-991111-5
Description:
mesoderm specific transcript [Source:RefSeq peptide;Acc:NP_571118]
Human Orthologue:
MEST
Human Description:
mesoderm specific transcript homolog (mouse) [Source:HGNC Symbol;Acc:7028]
Mouse Orthologue:
Mest
Mouse Description:
mesoderm specific transcript Gene [Source:MGI Symbol;Acc:MGI:96968]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40263 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40263
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041070 Essential Splice Site 187 344 6 12
ENSDART00000125389 Essential Splice Site 186 343 6 12
Genomic Location (Zv9):
Chromosome 4 (position 15065293)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16001146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACAGAAGCGGACACATCATTGTAAACAGCCTCTGCCTATCAAATGGAG[G/T]TATGTTTTCATTTAAGGCTTATTTCTTTGACATCGGAATAAAATGCATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link