mfsd6a

Ensembl ID:
ENSDARG00000032318
ZFIN ID:
ZDB-GENE-050208-335
Description:
Major facilitator superfamily domain-containing protein 6-A [Source:UniProtKB/Swiss-Prot;Acc:Q1LUQ4]
Human Orthologue:
MFSD6
Human Description:
major facilitator superfamily domain containing 6 [Source:HGNC Symbol;Acc:24711]
Mouse Orthologue:
Mfsd6
Mouse Description:
major facilitator superfamily domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1922925]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa29740 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29740
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063029 Nonsense 84 793 1 7
Genomic Location (Zv9):
Chromosome 22 (position 13064783)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 12900713
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCACCTTCTTGTGTCAAAAGTGTTTTATTTGTTCTTTTATGCCGCCTA[T/A]GGTTCCCTTCATCCCCTTCTTGCTCTCTACTACAAGCAGCTGGGGATGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link