tox

Ensembl ID:
ENSDARG00000032317
ZFIN ID:
ZDB-GENE-070912-181
Description:
Novel protein similar to thymocyte selection-associated high mobility group box (TOX) [Source:UniPro
Human Orthologue:
TOX
Human Description:
thymocyte selection-associated high mobility group box [Source:HGNC Symbol;Acc:18988]
Mouse Orthologue:
Tox
Mouse Description:
thymocyte selection-associated high mobility group box Gene [Source:MGI Symbol;Acc:MGI:2181659]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15155 Nonsense Available for shipment Available now
sa5130 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15155
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044371 Nonsense 71 539 3 10
ENSDART00000132039 Nonsense 49 225 2 4
ENSDART00000134912 Nonsense 71 203 3 5
Genomic Location:
Chromosome 2 (position 21839512)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAGTTCCGYGTTCCTGCGAGTCCCAGCCAGACGCAGCACAGCAACAAA[C/T]AGGCCGGCGGACACTGGAAAAGAGAGACCCAGACACACACGGATGGCCAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5130
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044371 Essential Splice Site 258 539 5 10
ENSDART00000132039 None None 225 None 4
ENSDART00000134912 None None 203 None 5
Genomic Location:
Chromosome 2 (position 21867764)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCGCCCTCCAGCTCCGTGCATGAGGACGATGCCGATGATGCTGCCAAGG[T/C]GAGCCAGTCTTACCCATTCTCTGATCTCAKGAATATAAAAGCTTATCTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cognitive performance: A genome-wide study of common SNPs and CNVs in cognitive performance in the CANTAB. (View Study)
  • Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y09n8gwf