tox

Ensembl ID:
ENSDARG00000032317
ZFIN ID:
ZDB-GENE-070912-181
Description:
Novel protein similar to thymocyte selection-associated high mobility group box (TOX) [Source:UniPro
Human Orthologue:
TOX
Human Description:
thymocyte selection-associated high mobility group box [Source:HGNC Symbol;Acc:18988]
Mouse Orthologue:
Tox
Mouse Description:
thymocyte selection-associated high mobility group box Gene [Source:MGI Symbol;Acc:MGI:2181659]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15155 Nonsense Available for shipment Available now
sa38325 Nonsense Mutation detected in F1 DNA During 2016
sa5130 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15155
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044371 Nonsense 71 539 3 10
ENSDART00000132039 Nonsense 49 225 2 4
ENSDART00000134912 Nonsense 71 203 3 5
Genomic Location:
Chromosome 2 (position 21839512)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAGTTCCGYGTTCCTGCGAGTCCCAGCCAGACGCAGCACAGCAACAAA[C/T]AGGCCGGCGGACACTGGAAAAGAGAGACCCAGACACACACGGATGGCCAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38325
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044371 Nonsense 160 539 4 10
ENSDART00000132039 Nonsense 138 225 3 4
ENSDART00000134912 Nonsense 161 203 4 5
Genomic Location:
Chromosome 2 (position 21854791)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTCACCTGCAAGGAATGGACCTGCCCGGCATGTTGAGTCCTAATATGT[T/A]GAGCCAAGATGGCAGCCTGCTCACCAACTCTCTCTCAGTGGTGAGTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5130
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044371 Essential Splice Site 258 539 5 10
ENSDART00000132039   None 225 None 4
ENSDART00000134912   None 203 None 5
Genomic Location:
Chromosome 2 (position 21867764)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCGCCCTCCAGCTCCGTGCATGAGGACGATGCCGATGATGCTGCCAAGG[T/C]GAGCCAGTCTTACCCATTCTCTGATCTCAKGAATATAAAAGCTTATCTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cognitive performance: A genome-wide study of common SNPs and CNVs in cognitive performance in the CANTAB. (View Study)
  • Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link