tbc1d20

Ensembl ID:
ENSDARG00000032298
ZFIN ID:
ZDB-GENE-050626-61
Description:
TBC1 domain family member 20 [Source:RefSeq peptide;Acc:NP_001020343]
Human Orthologue:
TBC1D20
Human Description:
TBC1 domain family, member 20 [Source:HGNC Symbol;Acc:16133]
Mouse Orthologue:
Tbc1d20
Mouse Description:
TBC1 domain family, member 20 Gene [Source:MGI Symbol;Acc:MGI:1914481]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24082 Nonsense Mutation detected in F1 DNA During 2014
sa16338 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24082
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045752 Nonsense 131 397 4 8
Genomic Location:
Chromosome 22 (position 10245944)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCGTGAGGGTCTTCAGGAGGAGCTCACCGATATTATTCTGCGTGTTT[T/A]GGTGAAAAACCCTCAGCTGCATTACTATCAGGGTTATCATGACATCGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16338
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045752 Nonsense 293 397 7 8
Genomic Location:
Chromosome 22 (position 10248430)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCMCGCATCCCAGAGGACCTGCCKTATGAAACGCTGATCAGCCGCGCT[G/T]GAGATCTGYTCGTGCAGTTTCCTCCATCAGAGCTRGCCAGAGAGCGCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ymalmyss