tbc1d20

Ensembl ID:
ENSDARG00000032298
ZFIN ID:
ZDB-GENE-050626-61
Description:
TBC1 domain family member 20 [Source:RefSeq peptide;Acc:NP_001020343]
Human Orthologue:
TBC1D20
Human Description:
TBC1 domain family, member 20 [Source:HGNC Symbol;Acc:16133]
Mouse Orthologue:
Tbc1d20
Mouse Description:
TBC1 domain family, member 20 Gene [Source:MGI Symbol;Acc:MGI:1914481]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29726 Nonsense Mutation detected in F1 DNA During 2015
sa24082 Nonsense Mutation detected in F1 DNA During 2015
sa16338 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29726
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045752 Nonsense 105 397 3 8
Genomic Location:
Chromosome 22 (position 10245750)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACAACAAAGACTTTAACCAGGTTCTTCTTGATGTTCAGCGGTCACTT[A/T]GACGCTTTCCTCCAGGTCAGCAGACCTATATTTTATTCTATTTTATTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24082
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045752 Nonsense 131 397 4 8
Genomic Location:
Chromosome 22 (position 10245944)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCGTGAGGGTCTTCAGGAGGAGCTCACCGATATTATTCTGCGTGTTT[T/A]GGTGAAAAACCCTCAGCTGCATTACTATCAGGGTTATCATGACATCGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16338
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045752 Nonsense 293 397 7 8
Genomic Location:
Chromosome 22 (position 10248430)
KASP Assay ID:
2261-6448.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCMCGCATCCCAGAGGACCTGCCKTATGAAACGCTGATCAGCCGCGCT[G/T]GAGATCTGYTCGTGCAGTTTCCTCCATCAGAGCTRGCCAGAGAGCGCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ymalmyss