rars2

Ensembl ID:
ENSDARG00000032277
ZFIN ID:
ZDB-GENE-040426-1244
Description:
probable arginyl-tRNA synthetase, mitochondrial [Source:RefSeq peptide;Acc:NP_956911]
Human Orthologue:
RARS2
Human Description:
arginyl-tRNA synthetase 2, mitochondrial [Source:HGNC Symbol;Acc:21406]
Mouse Orthologue:
Rars2
Mouse Description:
arginyl-tRNA synthetase 2, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:1923596]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17180 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17180
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104606 Essential Splice Site 365 597 12 20
ENSDART00000138753 None None 221 None 9
Genomic Location:
Chromosome 20 (position 2722835)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGCTGGACAGGAAGCAGAGGTTTAGCTTTGATGAGATGAWCTACGTGG[T/C]AAGGATGATGATAGTTCAGCSTGTTCTGTGTTCAATCCCATGATWCCTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4995fo76