mybl2

Ensembl ID:
ENSDARG00000032264
ZFIN ID:
ZDB-GENE-041007-1
Description:
myb-related protein B [Source:RefSeq peptide;Acc:NP_001003867]
Human Orthologue:
MYBL2
Human Description:
v-myb myeloblastosis viral oncogene homolog (avian)-like 2 [Source:HGNC Symbol;Acc:7548]
Mouse Orthologue:
Mybl2
Mouse Description:
myeloblastosis oncogene-like 2 Gene [Source:MGI Symbol;Acc:MGI:101785]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14950 Essential Splice Site Available for shipment Available now
sa35002 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14950
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040577 Essential Splice Site 94 633 4 16
ENSDART00000121489 Essential Splice Site 94 633 4 15
ENSDART00000137479   None 240 None 5
Genomic Location (Zv9):
Chromosome 11 (position 1519739)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 1527879
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RGATCCTGATCTTGTYAAAGGACCCTGGACYAAGGAGGAGGACGAGAAGG[T/C]AAAATNNNNGTAGAGACTGCAGTGGAGTTAATGGATTATATCACWACAGTYWAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35002
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040577 Nonsense 316 633 9 16
ENSDART00000121489 Nonsense 316 633 9 15
ENSDART00000137479   None 240 None 5
Genomic Location (Zv9):
Chromosome 11 (position 1527108)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 1535248
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCATGTCGGACTTCGACCTGCCGGAGGAGAGCCAGAGCTCGGAGCTCT[T/A]GCAGTTTCGTCTGGAGGGCAGTGCACTGCAAGAGCTCAGCAAGGGCAGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link