LOC556973

Ensembl ID:
ENSDARG00000032256
Human Orthologue:
TXNDC16
Human Description:
thioredoxin domain containing 16 [Source:HGNC Symbol;Acc:19965]
Mouse Orthologue:
Txndc16
Mouse Description:
thioredoxin domain containing 16 Gene [Source:MGI Symbol;Acc:MGI:1917811]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16235 Essential Splice Site Available for shipment Available now
sa18081 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16235
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105064 Essential Splice Site 434 804 12 19
Genomic Location:
Chromosome 17 (position 14786677)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATGGCTTTCATTCAGTCGTATGTGGAGGTGGCAGAAGCAGTCGAAGG[T/C]AAAAGCACTTCTCTGAACAATATTGCAGAATGTTGAAGTGCTGTAAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18081
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105064 Essential Splice Site 565 804 15 19
Genomic Location:
Chromosome 17 (position 14777889)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAGAGACCATTATTGGGCTGTTTRCCCATAAAGAGGCGGCAAAATGG[T/C]ATCWGSATGTTTCACCACAACTATTCTAATGACGTAATATGCTTAAGATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rm8q1txc