LOC556973

Ensembl ID:
ENSDARG00000032256
Human Orthologue:
TXNDC16
Human Description:
thioredoxin domain containing 16 [Source:HGNC Symbol;Acc:19965]
Mouse Orthologue:
Txndc16
Mouse Description:
thioredoxin domain containing 16 Gene [Source:MGI Symbol;Acc:MGI:1917811]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42892 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42891 Nonsense Mutation detected in F1 DNA During 2016
sa16235 Essential Splice Site Available for shipment Available now
sa18081 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42892
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105064 Essential Splice Site 196 804 7 19
Genomic Location (Zv9):
Chromosome 17 (position 14795293)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 14946121
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTCCTCTCCTTCTTCAGTGTCTCTCTGATATTTTGTTTTTGTTTCAC[A/T]GGGTTGTCAACCCGTCGTCCTCACAAGCTCGACTGTGGTTTCTGCACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42891
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105064 Nonsense 201 804 7 19
Genomic Location (Zv9):
Chromosome 17 (position 14795277)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 14946105
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGTGTCTCTCTGATATTTTGTTTTTGTTTCACAGGGTTGTCAACCCGT[C/A]GTCCTCACAAGCTCGACTGTGGTTTCTGCACTGTAAAAGTGTATCCCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16235
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105064 Essential Splice Site 434 804 12 19
Genomic Location (Zv9):
Chromosome 17 (position 14786677)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 14937505
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATGGCTTTCATTCAGTCGTATGTGGAGGTGGCAGAAGCAGTCGAAGG[T/C]AAAAGCACTTCTCTGAACAATATTGCAGAATGTTGAAGTGCTGTAAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18081
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105064 Essential Splice Site 565 804 15 19
Genomic Location (Zv9):
Chromosome 17 (position 14777889)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 14928717
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAGAGACCATTATTGGGCTGTTTRCCCATAAAGAGGCGGCAAAATGG[T/C]ATCWGSATGTTTCACCACAACTATTCTAATGACGTAATATGCTTAAGATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link