tnnt2c

Ensembl ID:
ENSDARG00000032242
ZFIN ID:
ZDB-GENE-030520-1
Description:
troponin T1, skeletal, slow [Source:RefSeq peptide;Acc:NP_852476]
Human Orthologue:
TNNT2
Human Description:
troponin T type 2 (cardiac) [Source:HGNC Symbol;Acc:11949]
Mouse Orthologue:
Tnnt2
Mouse Description:
troponin T2, cardiac Gene [Source:MGI Symbol;Acc:MGI:104597]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa224 Nonsense Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa224
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044154 Nonsense 55 290 1 1
Genomic Location:
Chromosome 4 (position 11096731)
KASP Assay ID:
554-0158.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAGTTGAGGAAGAACAAGAAGAAGCTGAGGAAGGAGACGAACCTGAA[G/T]AGACACATCAAGAAGAAGCAGACGATGAGCATGAAGCTGAAGAAGACACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cardiac Troponin-T levels: Association of genome-wide variation with highly sensitive cardiac troponin-T levels in European Americans and Blacks: a meta-analysis from atherosclerosis risk in communities and cardiovascular health studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n8lyy9wp