si:dkey-19f21.3

Ensembl ID:
ENSDARG00000032238
ZFIN ID:
ZDB-GENE-040724-76
Description:
dynamin-3 [Source:RefSeq peptide;Acc:NP_001121996]
Human Orthologue:
DNM3
Human Description:
dynamin 3 [Source:HGNC Symbol;Acc:29125]
Mouse Orthologue:
Dnm3
Mouse Description:
dynamin 3 Gene [Source:MGI Symbol;Acc:MGI:1341299]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23656 Essential Splice Site Available for shipment Available now
sa32280 Nonsense Available for shipment Available now
sa13688 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23656
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047039 Essential Splice Site 129 825 4 20
ENSDART00000141290   None 229 None 5
Genomic Location (Zv9):
Chromosome 20 (position 14816033)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 15005279
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAATATCTTCTCACATTTCTCTTTCTTTATTTCTCTTTTTCAATCTTCA[G/A]TGTTGAACCTGACTCTGATAGATCTTCCAGGCATAACTAAAGTGCCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32280
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047039 Nonsense 548 825 14 20
ENSDART00000141290   None 229 None 5
Genomic Location (Zv9):
Chromosome 20 (position 14792638)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 14981884
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGGATCCAAGGAGTATTGGTTCGTGCTCACCGCAGAGAGCCTATCCT[G/A]GTTTAAAGACGACGAGGCGAGTAACTGCATTTAAGTGTGCTGTTTCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13688
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047039 Nonsense 645 825 17 20
ENSDART00000141290 Nonsense 114 229 4 5
Genomic Location (Zv9):
Chromosome 20 (position 14758400)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 14947646
KASP Assay ID:
2261-4067.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGGAGATGGTTCAAGCCAGAYGGAGAGCTTCTCTATGGACCCTCAGT[T/A]GGAGCGTCAGGTCGAGACCATCCGCAACCTGGTGGACTCCTACATGASCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)
  • Mean platelet volume: A genome-wide meta-analysis identifies 22 loci associated with eight hematological parameters in the HaemGen consortium. (View Study)
  • Platelet counts: New gene functions in megakaryopoiesis and platelet formation. (View Study)
  • Waist-hip ratio: Meta-analysis identifies 13 new loci associated with waist-hip ratio and reveals sexual dimorphism in the genetic basis of fat distribution. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link