phactr4

Ensembl ID:
ENSDARG00000032221
ZFIN ID:
ZDB-GENE-040426-1131
Description:
Phosphatase and actin regulator 4 [Source:UniProtKB/Swiss-Prot;Acc:Q6PEI3]
Human Orthologue:
PHACTR4
Human Description:
phosphatase and actin regulator 4 [Source:HGNC Symbol;Acc:25793]
Mouse Orthologue:
Phactr4
Mouse Description:
phosphatase and actin regulator 4 Gene [Source:MGI Symbol;Acc:MGI:2140327]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22898 Nonsense Available for shipment Available now
sa13740 Nonsense Available for shipment Available now
sa14374 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22898
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044235 Nonsense 51 754 4 15
ENSDART00000081066 Nonsense 51 810 2 13
ENSDART00000145017   None 282 None 3
ENSDART00000145485 Nonsense 65 75 2 2
Genomic Location (Zv9):
Chromosome 16 (position 36651493)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 34280114
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTCTCTACCCTGGGGAAGATCTTCAAACCCTGGAAGTGGAGGAAGAAG[A/T]AAAGCAGCGAGAAGTTTAAGGAAACTTCAGAAGGTCCTTTGTTCTTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13740
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044235 Nonsense 68 754 5 15
ENSDART00000081066 Nonsense 68 810 3 13
ENSDART00000145017   None 282 None 3
ENSDART00000145485   None 75 None 2
Genomic Location (Zv9):
Chromosome 16 (position 36647525)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 34276146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGATWTATATTGTTTTTGTTCCCTCCACAGTTTTGGAAAGAAAGATGT[C/A]RATGAGGAGGCCAAGACAGGAACTGATTGAGCAGGGAGTGCTCAAGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14374
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044235 Essential Splice Site 368 754 7 15
ENSDART00000081066 Essential Splice Site 368 810 5 13
ENSDART00000145017   None 282 None 3
ENSDART00000145485   None 75 None 2
Genomic Location (Zv9):
Chromosome 16 (position 36639738)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 34268359
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
MTGCCTCCACCCAAACCCATCAACCGCAGCAACAACCCTGCCATTATGGG[T/C]GAGTGAATAWAAGATATAATGTGACCTCTGTAAATGTCAGAGAAATTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link