cthl

Ensembl ID:
ENSDARG00000032206
ZFIN ID:
ZDB-GENE-040905-3
Description:
cystathionase (cystathionine gamma-lyase), like [Source:RefSeq peptide;Acc:NP_001005400]
Human Orthologue:
CTH
Human Description:
cystathionase (cystathionine gamma-lyase) [Source:HGNC Symbol;Acc:2501]
Mouse Orthologue:
Cth
Mouse Description:
cystathionase (cystathionine gamma-lyase) Gene [Source:MGI Symbol;Acc:MGI:1339968]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11242 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11242
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104200 Essential Splice Site 332 400 9 12
ENSDART00000136314 Essential Splice Site 336 404 9 12
Genomic Location:
Chromosome 6 (position 37344953)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATAAAAGGAMAACTTGAGCATGCCTCAACCTTCCTCAGCAATCTGAAGG[T/A]GCTCAAAAGCATCMTAYTGTTGAAAAATCTTTWACATCTTRTGTTTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tx2oczf8