rgn

Ensembl ID:
ENSDARG00000032200
ZFIN ID:
ZDB-GENE-040718-68
Description:
Regucalcin [Source:UniProtKB/Swiss-Prot;Acc:Q6TLF6]
Human Orthologue:
RGN
Human Description:
regucalcin (senescence marker protein-30) [Source:HGNC Symbol;Acc:9989]
Mouse Orthologue:
Rgn
Mouse Description:
regucalcin Gene [Source:MGI Symbol;Acc:MGI:108024]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33811 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33811
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049384 Essential Splice Site 184 295 4 7
Genomic Location (Zv9):
Chromosome 6 (position 8659301)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 8900985
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTTCATGGTGGAGGCCTTCGACTATGACATCCAAACTGGAGGATTGTG[T/C]GAGTGTTTTGCATTTGACTCTGGTCCTAAAGGTGGCCTATTATGCAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link