gpc3

Ensembl ID:
ENSDARG00000032199
ZFIN ID:
ZDB-GENE-031212-1
Description:
Glypican 3 [Source:UniProtKB/TrEMBL;Acc:Q6V9Y8]
Human Orthologue:
GPC3
Human Description:
glypican 3 [Source:HGNC Symbol;Acc:4451]
Mouse Orthologue:
Gpc3
Mouse Description:
glypican 3 Gene [Source:MGI Symbol;Acc:MGI:104903]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42411 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42411
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039554 Nonsense 128 507 3 8
ENSDART00000129345 Nonsense 104 483 1 6
ENSDART00000143894   None 54 None 1
Genomic Location (Zv9):
Chromosome 14 (position 32195140)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 30984947
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGGAAAGGGAGCTCTGCTTATGGGTCATTTCCCAAGATGATGATGACC[C/T]GACTGTCCCGCTCACTCCTGGCCACTCGGGTCTTCCTGCAAGCGCTGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link