puf60a

Ensembl ID:
ENSDARG00000032175
ZFIN ID:
ZDB-GENE-030131-2891
Description:
poly(U)-binding-splicing factor PUF60 [Source:RefSeq peptide;Acc:NP_001099058]
Human Orthologue:
PUF60
Human Description:
poly-U binding splicing factor 60KDa [Source:HGNC Symbol;Acc:17042]
Mouse Orthologue:
Puf60
Mouse Description:
poly-U binding splicing factor 60 Gene [Source:MGI Symbol;Acc:MGI:1915209]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25112 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25112
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056645 Nonsense 79 538 3 11
ENSDART00000098863 Nonsense 78 518 5 12
ENSDART00000129931 Nonsense 93 291 4 8
ENSDART00000133311 Nonsense 79 162 6 8
ENSDART00000133660   None 366 None 8
ENSDART00000134539 Nonsense 79 233 5 8
ENSDART00000138371 Nonsense 79 162 6 8
ENSDART00000139179 Nonsense 79 236 5 8
ENSDART00000144613 Nonsense 79 519 5 12
ENSDART00000145810 Nonsense 91 289 4 8

The following transcripts of ENSDARG00000032175 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 32384403)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 32683310
KASP Assay ID:
554-7388.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAAATGGCATCGTTAACGATGGGTTTTGGAGATCCCCTCTCACCACTA[C/T]AGTCTGTAAGTACAAGTTTGTCGCTGTAATCTCAGTTGTCTTCATACTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link